M. mycoides JCVI-syn1.0 The J. Craig Venter Institute's "synthetic cell." JCVI

When the J. Craig Venter Institute announced last week that it had created the first "synthetic cell," whose genome had been synthesized artificially one base pair at a time, Venter himself mentioned that the genetic code had been tagged throughout with watermarks that identify it as man-made rather than natural code. Now we're hearing that those watermarks weren't arbitrary. The code carries four hidden messages, little Easter eggs for genetics wonks to find and decipher.

This isn't the first time Venter and company have played cheeky with genetic code. In 2008, researchers at JCVI used the four letters that identify the four bases in DNA -- A, G, C, and T -- to create a simple code based on codons, three-letter groups that code for amino acids. Using a different codon to represent one of 20 letters in the alphabet (not all letters are represented, so "v" is used interchangeably with "u," etc.), the research team embedded their names in the genetic code as follows:

  • CRAIGVENTER coded as:
    TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA
  • VENTERINSTITVTE coded as:
    TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAG TTAACTAGCTAA
  • HAMSMITH coded as: TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA
  • CINDIANDCLYDE coded as: TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTA GCTAATGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGT CGCCCTAAAACAAAGTTAAACATCATG
  • GLASSANDCLYDE coded as:
    TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA

For their latest research coup, the team went a bit further, adding not only their names but three other hidden messages within the code. One is an explanation of the coding system itself. The code also includes a handful of famous quotes ("TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE" from James Joyce's A Portrait of the Artist as a Young Man is just one of the appropriate selections) and a URL that ambitious genome geeks can decipher and visit as proof that they cracked the code.

See kids, science really is fun. But the watermarks aren't just proof that geneticists possess a sense of whimsy, nor do they simply mark the DNA as artificial. They are a kind of certificate of authenticity that proves Venter and his team really did build their cell one painstaking base pair at a time, from the ground up.

And if, as some critics have suggested, tinkering with genomes someday unleashes an unimaginable plague upon the world, the watermarks also serve as a signature. Your name is on the product now, Venter. Don't screw this one up.

For some added background on the watermarks as well as the synthetic cell project on the whole, check out the Science interview with Craig Venter below.


[Singularity Hub]

9 Comments

how and the heck do you read those names in those codes.

i suppose every three letters is the name of an amino acid and the first letter of the amino acid is used for the letters in their name.

ok... some researching and its not amino acids....

You just have to figure it out using a cipher that they have and we don't. In theory, now that they put those names up there, we do. Take the first example:
TTA ACT AGC TAA TGT CGT GCA ATT GGA GTA GAG AAC ACA GAA CGA TTA ACT AGC TAA
should equate to CRAIGVENTER, but the letters and number of groups don't match up..Maybe he has DOCTOR spelled out in the beginning or something. 19 groups of acids for only 11 present letters..

Here comes Splice. x) Lol.

They really had some fun with this project :)
Ivan Malagurski

This is the exact thing which ppl hate about genetic engineering,
ppl dont know the consequences(how does a single gene define a whole set of behavior) and they start playing with it...

I mean its a gene for god sake in which u r encoding names,quotes,jokes blah blah blah..
Let me give u an analog.
Lets suppose we can program a brain of a person(let suppose)
would it be wise and ethical to put in memories of a quote,jokes,names in his memory or do a dance when he hears a particular name....

@FrogOutOfaWell: Relax. I'm sure they were smart enough to only put this stuff in the telomeres of the chromosomes, not in the middle of an actual encoding gene. Especially since the thing lived; if they put in random junk information (encoding into English will almost definitely be junk in terms of the protein it makes) into an actually translated gene, I'd bet twenty million dollars the cell would die virtually instantly with some toxic effects of protein buildup.

The function of telomeres is simply to "be long" to prevent genetic damage over many generations of replication. So the information in them doesn't matter as it's not used; it just needs to be a long strand of DNA at the ends of the chromosomes. So if the information doesn't matter anyway, why not leave a message after the beep...or in the case, leave a message after the genes? :P

-IMP ;) :)

It's quite a simple code. Multiple codons code for the same amino acid and each amino acid was assigned the known single letter code. The first 4 and last 4 codons are always the same and would provide a unique primer (unique for the 3 million basepairs of this organism).
TTA =Primer?
ACT =Primer?
AGC =Primer?
TAA =Primer? STOP TAA, TAG, TGA
TGT = C = Cysteine TGT, TGC
CGT = R = Arginine  CGT, CGC, CGA, CGG, AGA, AGG
GCA = A = Alanine GCT, GCC, GCA, GCG
ATT = I = Isoleucine ATT, ATC, ATA
GGA = G = Glycine GGT, GGC, GGA, GGG
GTA = V = Valine GTT, GTC, GTA, GTG
GAG = E = Glutamic acid   GAA, GAG
AAC = N = Asparagine AAT, AAC
ACA = T = Threonine ACT, ACC, ACA, ACG
GAA = E = Glutamic acid   GAA, GAG
CGA = R = Arginine  CGT, CGC, CGA, CGG, AGA, AGG
TTA Control?
ACT Control?
AGC Control?
TAA Control? STOP TAA, TAG, TGA

@FrogOutOfaWell
The vast majority of the nucleotides in a DNA strand do not encode genes for proteins. In fact, only 1.5% of the entire human genome actually codes for proteins, while over 50% of it consists on long repetitive sequences, much of which has little or no function. Venter adding these sequences to his synthetic bacteria is completely harmless.


138 years of Popular Science at your fingertips.



Popular Science+ For iPad

Each issue has been completely reimagined for your iPad. See our amazing new vision for magazines that goes far beyond the printed page



Download Our App

Stay up to date on the latest news of the future of science and technology from your iPhone or Android phone with full articles, images and offline viewing



Follow Us On Twitter

Featuring every article from the magazine and website, plus links from around the Web. Also see our PopSci DIY feed


March 2012: The Future of Medicine

A 10,000-rpm, no-pulse heart is completely revolutionizing how we think about transplants. Plus: rapid-response virus hunters, a shocking cure for migraines, the world's youngest person to have achieved nuclear fusion (in his parents' garage!), and much more.


circ-top-header.gif
circ-cover.gif
bmxmag-ps